Application of Cas13b and Cas13a in RNA manipulation

  • PT0011
  • ¥8800.00
  • 我要询价

Application of Cas13b and Cas13a in RNA manipulation

Application of Cas13b and Cas13a in RNA manipulation

Cas9 amd Cpf1 endoucleases have been largely acquainted with targeting double-stranded DNA (dsDNA) and editing genome. In contrast, Type VI CRISPR-Cas systems, such as Cas13a and Cas13b endonucleases-crRNA recognize single-stranded RNA (ssRNA). For example, we can easily use Cas13a and Cas13b systems to shape one nucleotide in RNA level, which ultimately leads to change the amino acid sequence. Here we describe how Cas13a and Cas13b endonucleases in modification of codon and amino sequence and their possible application in protein engineering, viral attenuation in RNA virus, RNA virus direct evolution, Vaccine development, RNA knock out etc.. For RNA knockout, you should use Cas13a and Cas13b plasmids, whereas for for RNA nucleotide modification, you should use Cas13b-NES-ADAR2DD.

 

Plasmids used in the protocol:

Cas13b-NES-ADAR2DD:

Cas13b-NES:

Cas13b-CrRNA:

Cas13a:

Cas13a-CrRNA:


Comparison of endoucleases: Cas9, Cpf1 and Cas13a

Type

Domian

Guide RNA

Targets

PAM

Cas9

HNHRuvC

tracrRNAcrRNA

DNA

5' NGG

Cpf1

类似RuvC

crRNA

DNA

5' TTN

Cas13a

2x HEPN

crRNA

RNA

3' AU C


Procedure

 

1. Synthesis target oligos.

 

Oligo-Forward: CACC-(N)40-50

Oligo-Reverse: CAAC-(N)40-50R

 

2. Annealing


Oligo-Forward (100uM)        

1 ul

Oligo-Reverse (100uM)         

1 ul

10x T4 ligase buffer

1 ul

T4 PNK

1 ul

H2O

6 ul

Total volume

10 ul

On thermal cycler with heat lid.

37 ℃, 30 min

95 ℃, 5 min

Ramp down to 25℃ at 0.1℃/sec. (when step 25℃ is highlighted, click option, set Ramp as 0.1℃/sec)

25 ℃, 5 min

4 ℃, 5 min

Put on ice, or keep in -20℃ freezer for storage.

 

3. Digest cas13a crRNA (Cas13b crRNA) with BbsI 

Plasmid        

6-10 ug

BbsI        

2 ul

10x buffer

5 ul

H2O

Up to 50 ul

Total volume

50 ul

Purify the enzyme digested product with PCR product purification kit, and make sure that the concentration is more than 50 ng/ul.

4. Ligation

Dilute the annealed target oligos 200 times for further ligation

Diluted annealed oligos        

2 ul

Digested plasmid         

100 ng

10x T4 ligase buffer

1 ul

T4 ligase

1 ul

H2O

Up to 10 ul

Total volume

10 ulLigate for more than 2 hours at 16 ℃. (Overnight is better.)

Ligate for more than 2 hours at 16 ℃. (Overnight is better.)

5. Transformation and identification of positive clones

Pick single clones and culture for several hours in 37℃ incubator, and perform PCR to identify the positive clones.

Use Oligo-Forward and Guide seq-R as primers, and the PCR product is about 600 bp.

Oligo-Forward 

CACC-(N)20

Guide seq-R

GTCTAAGAAACCATTATTATCAT

 

6. Plasmid extraction and sequencing validation.

Culture the positive clone in 4-6 ml Amp+ LB medium, and extract plasmid.




          Use Guide seq-R as sequencing primer.

Examples:

CrRNA designed for nucleotide modification in RNA genome of Influenza A virus (A/Puerto Rico/8/1934(H1N1)) virus:

 

K391E (AAA-GAA)

Oligo-Forward: CACC-GTATTAAGAGCGGTCGGATTTCTTCAATCTTCTTTCTTGTTGAATC

Oligo-Reverse: CAAC-GATTCAACAAGAAAGAAGATTGAAGAAATCCGACCGCTCTTAATAC

E581G(GAG-GGG)

Oligo-Forward: CACC-GCAGCTTTGGAACGGGTTTGCCCCCACAGTTTCTTTATTTCAAATGA

Oligo-Reverse: CAAC-TCATTTGAAATAAAGAAACTGTGGGGGCAAACCCGTTCCAAAGCTGC

A661T(GCA-ACA)

Oligo-Forward: CACC-GGGGATCCAGGAGTGTGTTGTTGTAACAGCATCATACTCCATGTT

Oligo-Reverse: CAAC-AACATGGAGTATGATGCTGTTACAACAACACACTCCTGGATCCCC

N265S (AAC-AGC)

Oligo-Forward: CACC-AGCTTGATTATTGCTGCTAGGAGCATAGTGAGAAGAGCTGCAGTA

Oligo-Reverse:CAAC-TACTGCAGCTCTTCTCACTATGCTCCTAGCAGCAATAATCAAGCT

产品